Stem-loop sequence oan-mir-7417

AccessionMI0024073 (change log)
DescriptionOrnithorhynchus anatinus miR-7417 stem-loop
Stem-loop
   ---uu    a              cacaa   aa 
5'      cccc cucugagcacacag     agu  u
        |||| ||||||||||||||     |||   
3'      gggg gagacucguguguc     uca  c
   cuaac    -              -----   ca 
Get sequence
Deep sequencing
51 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig6786: 3507-3567 [-]
intergenic
Database links

Mature sequence oan-miR-7417-5p

Accession MIMAT0028982
Sequence

1 - 

uuccccacucugagcacacagc

 - 22

Get sequence
Deep sequencing51 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7417-3p

Accession MIMAT0028983
Sequence

40 - 

ugugugcucagagggggcaauc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).