Stem-loop sequence oan-mir-181a-3

AccessionMI0024072 (change log)
DescriptionOrnithorhynchus anatinus miR-181a-3 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   --a          cu       a      g ag 
5'    acauucaacg  gucggug guuugg c  u
      ||||||||||  ||||||| |||||| |   
3'    ugugaguugc  cagccac caaauu g  a
   cca          --       -      g ag 
Get sequence
Deep sequencing
1724460 reads, 2.66e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig65528: 2999-3061 [-]
intergenic
Clustered miRNAs
< 10kb from oan-mir-181a-3
oan-mir-181a-3Contig65528: 2999-3061 [-]
oan-mir-181cContig65528: 2622-2716 [-]
Database links

Mature sequence oan-miR-181a-5p

Accession MIMAT0006833
Previous IDsoan-miR-181a
Sequence

1 - 

aacauucaacgcugucggugagu

 - 23

Get sequence
Deep sequencing5153740 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-miR-181a-3-3p

Accession MIMAT0031027
Sequence

43 - 

ccaccgaccguugaguguacc

 - 63

Get sequence
Deep sequencing6871 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).