Stem-loop sequence oan-mir-222b-2

AccessionMI0024071 (change log)
DescriptionOrnithorhynchus anatinus miR-222b-2 stem-loop
Gene family MIPF0000051; mir-221
Stem-loop
   --        ug -     gau    -  gaca 
5'   ucaguagu  g uguag   cugu cu    u
     ||||||||  | |||||   |||| ||     
3'   ggucauua  c acauc   gaca ga    g
   ug        gu u     ---    a  auua 
Get sequence
Deep sequencing
1660 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra519: 9176998-9177058 [-]
sense
ENSOANT00000034771 ; oan-mir-222b-2-201; exon 1
Database links

Mature sequence oan-miR-222b-5p

Accession MIMAT0007056
Previous IDsoan-miR-222b*
Sequence

1 - 

ucaguaguugguguaggaucugu

 - 23

Get sequence
Deep sequencing22 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-222b-3p

Accession MIMAT0007057
Previous IDsoan-miR-222b
Sequence

41 - 

agcuacaucugauuacugggu

 - 61

Get sequence
Deep sequencing5044 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).