Stem-loop sequence oan-mir-7416

AccessionMI0024070 (change log)
DescriptionOrnithorhynchus anatinus miR-7416 stem-loop
Stem-loop
   -agc             ag     --caa a 
5'     ccuuagucccaga  agagc     g a
       |||||||||||||  |||||     |  
3'     gggguuagggucu  ucucg     c u
   ucua             -a     acgag u 
Get sequence
Deep sequencing
253 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
20: 270668-270727 [-]
intergenic
Database links

Mature sequence oan-miR-7416-5p

Accession MIMAT0028980
Sequence

1 - 

agcccuuagucccagaagagagc

 - 23

Get sequence
Deep sequencing30 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7416-3p

Accession MIMAT0028981
Sequence

40 - 

ucuaucugggauuggggaucu

 - 60

Get sequence
Deep sequencing223 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).