Stem-loop sequence oan-mir-365-2

AccessionMI0024069 (change log)
DescriptionOrnithorhynchus anatinus miR-365-2 stem-loop
Gene family MIPF0000061; mir-365
Stem-loop
   -g     c   c       -----    u   u 
5'   aggga uuu aggggca     gcug guu u
     ||||| ||| |||||||     |||| ||| a
3'   uuccu aaa uccccgu     ugac cag c
   ua     a   a       aauac    c   u 
Get sequence
Deep sequencing
1873 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig524: 665453-665515 [+]
sense
ENSOANT00000025959 ; oan-mir-365-2-201; exon 1
Database links

Mature sequence oan-miR-365-2-5p

Accession MIMAT0031067
Sequence

1 - 

gagggacuuucaggggcagcugu

 - 23

Get sequence
Deep sequencing12 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-365-3p

Accession MIMAT0006823
Previous IDsoan-miR-365
Sequence

42 - 

uaaugccccuaaaaauccuuau

 - 63

Get sequence
Deep sequencing3899 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).