Stem-loop sequence oan-mir-181a-2

AccessionMI0024068 (change log)
DescriptionOrnithorhynchus anatinus miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   --a   u      cu       a    gagau 
5'    aca ucaacg  gucggug guuu     a
      ||| ||||||  ||||||| ||||      
3'    ugu aguugc  cagcuac caaa     g
   cca   c      --       -    gaaga 
Get sequence
Deep sequencing
1774313 reads, 2.72e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig3879: 5169-5229 [-]
sense
ENSOANT00000026185 ; oan-mir-181a-2-201; exon 1
Clustered miRNAs
< 10kb from oan-mir-181a-2
oan-mir-181a-2Contig3879: 5169-5229 [-]
oan-mir-181b-2Contig3879: 3672-3731 [-]
Database links

Mature sequence oan-miR-181a-5p

Accession MIMAT0006833
Previous IDsoan-miR-181a
Sequence

1 - 

aacauucaacgcugucggugagu

 - 23

Get sequence
Deep sequencing5153740 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-miR-181a-2-3p

Accession MIMAT0031026
Sequence

41 - 

ccaucgaccguugacuguacc

 - 61

Get sequence
Deep sequencing56733 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).