Stem-loop sequence oan-mir-181b-2

AccessionMI0024067 (change log)
DescriptionOrnithorhynchus anatinus miR-181b-2 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   --aa         cu           uu gu 
5'     cauucauug  gucgguggguu  u  c
       |||||||||  |||||||||||  |   
3'     guaaguaac  uagucacucaa  a  u
   aaac         --           cu ag 
Get sequence
Deep sequencing
339776 reads, 5.12e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig3879: 3672-3731 [-]
sense
ENSOANT00000025747 ; oan-mir-181b-2-201; exon 1
Clustered miRNAs
< 10kb from oan-mir-181b-2
oan-mir-181a-2Contig3879: 5169-5229 [-]
oan-mir-181b-2Contig3879: 3672-3731 [-]
Database links

Mature sequence oan-miR-181b-5p

Accession MIMAT0006835
Previous IDsoan-miR-181b
Sequence

1 - 

aacauucauugcugucggugg

 - 21

Get sequence
Deep sequencing677477 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-miR-181b-2-3p

Accession MIMAT0031055
Sequence

42 - 

acugaucaaugaaugcaaa

 - 60

Get sequence
Deep sequencing1003 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).