Stem-loop sequence oan-mir-7415

AccessionMI0024066 (change log)
DescriptionOrnithorhynchus anatinus miR-7415 stem-loop
Stem-loop
   --  a  g  g     u  g      -    
5'   ga uu uu uucuc ga agcgcg ccu 
     || || || ||||| || |||||| || g
3'   cu ag aa aggag cu uugugc gga 
   uu  g  g  g     u  a      a    
Get sequence
Deep sequencing
117 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig349: 86725-86782 [-]
sense
ENSOANT00000012556 ; oan-mir-7415-201; exon 10
Database links

Mature sequence oan-miR-7415-5p

Accession MIMAT0028978
Sequence

1 - 

gaauuguuguucucugagagc

 - 21

Get sequence
Deep sequencing97 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7415-3p

Accession MIMAT0028979
Sequence

38 - 

uaucugaggagaaggagucuu

 - 58

Get sequence
Deep sequencing12 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).