Stem-loop sequence oan-mir-7414

AccessionMI0024065 (change log)
DescriptionOrnithorhynchus anatinus miR-7414 stem-loop
Stem-loop
   --      c           g  -  ag 
5'   ugagcg ucgaucgagac au cg  u
     |||||| ||||||||||| || ||   
3'   auuugc aguuaguucug ua gu  g
   uc      a           g  a  aa 
Get sequence
Deep sequencing
50 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig33421: 1770-1824 [+]
sense
ENSOANT00000039830 ; PIAS2-201; intron 1
Database links

Mature sequence oan-miR-7414-5p

Accession MIMAT0028976
Sequence

1 - 

ugagcgcucgaucgagacgauc

 - 22

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7414-3p

Accession MIMAT0028977
Sequence

34 - 

uggucuugauugaacguuuacu

 - 55

Get sequence
Deep sequencing22 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).