Stem-loop sequence oan-mir-7413

AccessionMI0024064 (change log)
DescriptionOrnithorhynchus anatinus miR-7413 stem-loop
Stem-loop
   --u     a    --aga    -----  g     -    cu 
5'    ggcac gccg     uguc     gg uccac gggu  g
      ||||| ||||     ||||     || ||||| ||||   
3'    ccgug cggu     acgg     uu aggug cccg  g
   acc     a    agugg    aguuu  g     a    au 
Get sequence
Deep sequencing
230 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig3073: 48166-48241 [+]
intergenic
Database links

Mature sequence oan-miR-7413-5p

Accession MIMAT0028974
Sequence

1 - 

uggcacagccgagaugucgg

 - 20

Get sequence
Deep sequencing39 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7413-3p

Accession MIMAT0028975
Sequence

55 - 

ggcaggugauggcagugcccca

 - 76

Get sequence
Deep sequencing56 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).