Stem-loop sequence oan-mir-135b-2

AccessionMI0024063 (change log)
DescriptionOrnithorhynchus anatinus miR-135b-2 stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   --         uu            uccug 
5'   uauggcuuu  auuccuauguga     c
     |||||||||  ||||||||||||     u
3'   gugccgagg  uagggauauacu     g
   ac         -u            cacuc 
Get sequence
Deep sequencing
18058 reads, 280 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig26295: 4035-4094 [+]
sense
ENSOANT00000026077 ; oan-mir-135b-2-201; exon 1
Clustered miRNAs
< 10kb from oan-mir-135b-2
oan-mir-135b-2Contig26295: 4035-4094 [+]
oan-mir-1359Contig26295: 4350-4495 [+]
Database links

Mature sequence oan-miR-135b-5p

Accession MIMAT0006870
Previous IDsoan-miR-135b
Sequence

1 - 

uauggcuuuuuauuccuauguga

 - 23

Get sequence
Deep sequencing34513 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-miR-135b-2-3p

Accession MIMAT0031114
Sequence

39 - 

auauagggauuggagccgugca

 - 60

Get sequence
Deep sequencing805 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).