Stem-loop sequence oan-mir-1421an

AccessionMI0024062 (change log)
DescriptionOrnithorhynchus anatinus miR-1421an stem-loop
Gene family MIPF0000564; mir-1421
Stem-loop
   --a     c     auu      a  gaug 
5'    ggagg cguac   gugcag gc    g
      ||||| |||||   |||||| ||    c
3'    ccucc gcgug   uacguc ug    g
   auc     a     cgu      g  aaag 
Get sequence
Deep sequencing
205 reads, 25 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig251953: 416-476 [+]
sense
ENSOANT00000036643 ; oan-mir-1421an-201; exon 1
Database links

Mature sequence oan-miR-1421an-5p

Accession MIMAT0028972
Sequence

1 - 

aggaggccguacauugugcaga

 - 22

Get sequence
Deep sequencing180 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-1421an-3p

Accession MIMAT0028973
Sequence

40 - 

ugcauugcgugcgaccucccua

 - 61

Get sequence
Deep sequencing24 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).