Stem-loop sequence oan-mir-7412

AccessionMI0024061 (change log)
DescriptionOrnithorhynchus anatinus miR-7412 stem-loop
Stem-loop
   --u          c       u  ag   gc 
5'    cgggagagga aggacag ag  uug  a
      |||||||||| ||||||| ||  |||  g
3'    guccucuccu ucuuguc uc  aac  a
   ucc          u       -  cu   ac 
Get sequence
Deep sequencing
58 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig24448: 10552-10613 [+]
intergenic
Database links

Mature sequence oan-miR-7412-5p

Accession MIMAT0028970
Sequence

1 - 

ucgggagaggacaggacaguaga

 - 23

Get sequence
Deep sequencing45 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7412-3p

Accession MIMAT0028971
Sequence

41 - 

ucuguucuuuccucuccugccu

 - 62

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).