Stem-loop sequence oan-mir-7411

AccessionMI0024060 (change log)
DescriptionOrnithorhynchus anatinus miR-7411 stem-loop
Stem-loop
   --u            a    --ag     cac 
5'    ccgguaugucua aucu    augua   a
      |||||||||||| ||||    |||||    
3'    ggcuauguagau uaga    uauau   g
   auc            a    gcga     aua 
Get sequence
Deep sequencing
62 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig22752: 8385-8446 [+]
intergenic
Database links

Mature sequence oan-miR-7411-5p

Accession MIMAT0028968
Sequence

1 - 

uccgguaugucuaaaucuaga

 - 21

Get sequence
Deep sequencing59 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7411-3p

Accession MIMAT0028969
Sequence

42 - 

gagauauagauguaucggcua

 - 62

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).