Stem-loop sequence oan-mir-7410

AccessionMI0024059 (change log)
DescriptionOrnithorhynchus anatinus miR-7410 stem-loop
Stem-loop
   gcucu   --u    g  --     c 
5'      guc   gcua ac  cgcag c
        |||   |||| ||  ||||| c
3'      uag   cgau ug  gcguc u
   -caug   ucu    g  ua     c 
Get sequence
Deep sequencing
174 reads, 200 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
10: 10790698-10790747 [+]
intergenic
Database links

Mature sequence oan-miR-7410-5p

Accession MIMAT0028966
Sequence

1 - 

gcucugucugcuagaccgcagc

 - 22

Get sequence
Deep sequencing14 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7410-3p

Accession MIMAT0028967
Sequence

28 - 

ugcgauguguagcucugauguac

 - 50

Get sequence
Deep sequencing160 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).