Stem-loop sequence oan-mir-7409

AccessionMI0024058 (change log)
DescriptionOrnithorhynchus anatinus miR-7409 stem-loop
Stem-loop
   --u   cu  a  c      g   aaagug 
5'    ggg  gg gc ugcaca ugg      a
      |||  || || |||||| |||      a
3'    ccc  cc cg gcgugu acc      g
   agc   au  g  c      g   cuagau 
Get sequence
Deep sequencing
39 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig22196: 5889-5949 [+]
intergenic
Database links

Mature sequence oan-miR-7409-5p

Accession MIMAT0028964
Sequence

1 - 

ugggcuggagccugcacagugg

 - 22

Get sequence
Deep sequencing34 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7409-3p

Accession MIMAT0028965
Sequence

40 - 

agugugcgcgcgccuaccccga

 - 61

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).