Stem-loop sequence oan-mir-7408

AccessionMI0024057 (change log)
DescriptionOrnithorhynchus anatinus miR-7408 stem-loop
Stem-loop
   --ga      cc                 
5'     ggcugc  cgguggaggggagggu 
       ||||||  ||||||||||||||| g
3'     ccgacg  gcuaccucuccucccg 
   ucca      uc                 
Get sequence
Deep sequencing
47 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig210884: 560-614 [-]
intergenic
Database links

Mature sequence oan-miR-7408-5p

Accession MIMAT0028962
Sequence

1 - 

gaggcugccccgguggagggg

 - 21

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7408-3p

Accession MIMAT0028963
Sequence

35 - 

ucuccaucgcugcagccaccu

 - 55

Get sequence
Deep sequencing43 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).