Stem-loop sequence oan-mir-7407-2

AccessionMI0024056 (change log)
DescriptionOrnithorhynchus anatinus miR-7407-2 stem-loop
Gene family MIPF0001768; mir-7407
Stem-loop
   uaguga    ag     -   u       g a   c     uu 
5'       caag  cauag gcg gggagcc g gga ccggg  c
         ||||  ||||| ||| ||||||| | ||| |||||  u
3'       guuu  guguc cgu cucuugg c ccu ggccu  a
   ----gg    aa     u   -       g a   c     ua 
Get sequence
Deep sequencing
86 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra2: 861860-861942 [-]
sense
ENSOANT00000013120 ; C6orf141-201; intron 1
ENSOANT00000013121 ; oan-mir-7407-1-201; 3'UTR (exon 7)
Database links

Mature sequence oan-miR-7407-5p

Accession MIMAT0028960
Sequence

1 - 

uagugacaagagcauaggcgu

 - 21

Get sequence
Deep sequencing38 reads, 3 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7407-3p

Accession MIMAT0028961
Sequence

61 - 

guucucugcucugugaauuuggg

 - 83

Get sequence
Deep sequencing8 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).