Stem-loop sequence oan-mir-2985

AccessionMI0024052 (change log)
DescriptionOrnithorhynchus anatinus miR-2985 stem-loop
Gene family MIPF0001067; mir-2985
Stem-loop
   --        a   g           g 
5'   gugggugg aua uauaacaauau c
     |||||||| ||| ||||||||||| u
3'   cauccacc uau auauuguugua a
   cc        c   g           a 
Get sequence
Deep sequencing
35 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
12: 14208902-14208956 [-]
sense
ENSOANT00000024679 ; GRIA2-201; intron 13
Database links

Mature sequence oan-miR-2985-5p

Accession MIMAT0028956
Sequence

1 - 

guggguggaauaguauaacaau

 - 22

Get sequence
Deep sequencing22 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-2985-3p

Accession MIMAT0028957
Sequence

34 - 

uguuauaguaucccaccuaccc

 - 55

Get sequence
Deep sequencing13 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).