Stem-loop sequence oan-mir-7406

AccessionMI0024051 (change log)
DescriptionOrnithorhynchus anatinus miR-7406 stem-loop
Stem-loop
   -guc      ua             ucauu 
5'     agcgcu  acgggugccgucg     c
       ||||||  |||||||||||||     a
3'     ucgcga  uguccauggcagc     u
   cccu      gc             uuacu 
Get sequence
Deep sequencing
38 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig13581: 19131-19192 [-]
intergenic
Database links

Mature sequence oan-miR-7406-5p

Accession MIMAT0028954
Sequence

3 - 

cagcgcuuaacgggugccgucg

 - 24

Get sequence
Deep sequencing9 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7406-3p

Accession MIMAT0028955
Sequence

40 - 

acgguaccugucgagcgcuucc

 - 61

Get sequence
Deep sequencing22 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).