Stem-loop sequence oan-mir-7405

AccessionMI0024050 (change log)
DescriptionOrnithorhynchus anatinus miR-7405 stem-loop
Stem-loop
   --uc  a     ---uc    a  c   u uuu 
5'     ca ggcag     cuac uc ugu c   g
       || |||||     |||| || ||| |    
3'     gu ccguc     gaug ag aca g   u
   cgua  c     ucgua    g  a   c ucu 
Get sequence
Deep sequencing
223 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
11: 1968570-1968632 [+]
intergenic
Database links

Mature sequence oan-miR-7405-5p

Accession MIMAT0028952
Sequence

1 - 

uccaaggcaguccuacauccug

 - 22

Get sequence
Deep sequencing217 reads, 3 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7405-3p

Accession MIMAT0028953
Sequence

39 - 

agagguagaugcucugcccugaugc

 - 63

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).