Stem-loop sequence oan-mir-7404-2

AccessionMI0024049 (change log)
DescriptionOrnithorhynchus anatinus miR-7404-2 stem-loop
Gene family MIPF0001720; mir-7404
Stem-loop
   --a         a  a   g      g c 
5'    cgucccggg cg cuu aagucg c c
      ||||||||| || ||| |||||| |  
3'    gcagggccc gc gaa uucggc g a
   ucg         g  a   g      a g 
Get sequence
Deep sequencing
47 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra430: 296577-296634 [+]
intergenic
Database links

Mature sequence oan-miR-7404-5p

Accession MIMAT0028950
Sequence

1 - 

acgucccgggacgacuugaagu

 - 22

Get sequence
Deep sequencing76 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7404-3p

Accession MIMAT0028951
Sequence

37 - 

uugaagacggcccgggacggcu

 - 58

Get sequence
Deep sequencing12 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).