Stem-loop sequence oan-mir-133a-2

AccessionMI0024047 (change log)
DescriptionOrnithorhynchus anatinus miR-133a-2 stem-loop
Gene family MIPF0000029; mir-133
Stem-loop
   --       aa  u  a        aacug 
5'   agcuggu  aa gg accaaauc     u
     |||||||  || || ||||||||      
3'   ucgacca  uu cc ugguuuag     u
   ug       ac  c  c        guaac 
Get sequence
Deep sequencing
53816 reads, 840 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig101: 1040169-1040228 [-]
sense
ENSOANT00000025560 ; oan-mir-133a-2-201; exon 1
Database links

Mature sequence oan-miR-133a-5p

Accession MIMAT0006864
Previous IDsoan-miR-133a*
Sequence

1 - 

agcugguaaaauggaaccaaau

 - 22

Get sequence
Deep sequencing9056 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-miR-133a-3p

Accession MIMAT0006865
Previous IDsoan-miR-133a
Sequence

39 - 

uugguccccuucaaccagcugu

 - 60

Get sequence
Deep sequencing119289 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).