Stem-loop sequence oan-mir-7403

AccessionMI0024046 (change log)
DescriptionOrnithorhynchus anatinus miR-7403 stem-loop
Stem-loop
   --      ----- -uc      a      u uu   a   a 
5'   ucagag     c   ccagaa uggcua a  ggu gca a
     ||||||     |   |||||| |||||| |  ||| ||| u
3'   agucuc     g   ggucuu gucggu u  uca cgu u
   aa      auacu uaa      -      u uu   -   c 
Get sequence
Deep sequencing
53 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
7: 19288089-19288165 [+]
sense
ENSOANT00000018220 ; LRRFIP1-201; intron 12
Database links

Mature sequence oan-miR-7403-5p

Accession MIMAT0028948
Sequence

1 - 

ucagagcucccagaaauggcuau

 - 23

Get sequence
Deep sequencing51 reads, 3 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7403-3p

Accession MIMAT0028949
Sequence

50 - 

ggcuguucuggaaugucauacucugaaa

 - 77

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).