Stem-loop sequence oan-mir-7402

AccessionMI0024045 (change log)
DescriptionOrnithorhynchus anatinus miR-7402 stem-loop
Stem-loop
   --                       ---c   ga 
5'   uggacucagaauuuacaagacug    ugg  u
     |||||||||||||||||||||||    |||  a
3'   accugagucuuaaauguucugac    acc  g
   ac                       cagu   ac 
Get sequence
Deep sequencing
40 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
7: 14560156-14560221 [+]
intergenic
Database links

Mature sequence oan-miR-7402-5p

Accession MIMAT0028946
Sequence

1 - 

uggacucagaauuuacaagacu

 - 22

Get sequence
Deep sequencing39 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7402-3p

Accession MIMAT0028947
Sequence

45 - 

ucuuguaaauucugaguccaca

 - 66

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).