Stem-loop sequence oan-mir-7401

AccessionMI0024044 (change log)
DescriptionOrnithorhynchus anatinus miR-7401 stem-loop
Stem-loop
   --     c        c  g    uacu  c 
5'   cugug acagagua ug acua    cu c
     ||||| |||||||| || ||||    ||  
3'   gacgc ugucucgu ac ugau    ga c
   ac     a        a  a    ucac  a 
Get sequence
Deep sequencing
272 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
7: 406275-406336 [-]
intergenic
Database links

Mature sequence oan-miR-7401-5p

Accession MIMAT0028944
Sequence

1 - 

cugugcacagaguacuggacua

 - 22

Get sequence
Deep sequencing6 reads, 3 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7401-3p

Accession MIMAT0028945
Sequence

41 - 

guacaaugcucuguacgcagca

 - 62

Get sequence
Deep sequencing139 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).