Stem-loop sequence oan-mir-7400

AccessionMI0024043 (change log)
DescriptionOrnithorhynchus anatinus miR-7400 stem-loop
Stem-loop
   --aca     ac   cu      a    uua 
5'      ccucc  cgg  uucaga cggu   a
        |||||  |||  |||||| ||||   a
3'      ggagg  guc  aagucu gcua   c
   ccuca     gc   -c      c    cau 
Get sequence
Deep sequencing
267 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
6: 13044432-13044493 [+]
intergenic
Database links

Mature sequence oan-miR-7400-5p

Accession MIMAT0028942
Sequence

3 - 

accuccaccggcuuucagaacg

 - 24

Get sequence
Deep sequencing62 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7400-3p

Accession MIMAT0028943
Sequence

40 - 

cucugaaccugcgggaggacu

 - 60

Get sequence
Deep sequencing201 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).