Stem-loop sequence mdo-mir-7399

AccessionMI0024042 (change log)
DescriptionMonodelphis domestica miR-7399 stem-loop
Stem-loop
   --ca            ga       guau 
5'     cauacauauaua  cguguau    a
       ||||||||||||  |||||||     
3'     guauguauaugu  gcauaug    u
   guac            ac       aauc 
Get sequence
Deep sequencing
41 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 57326899-57326956 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7399
mdo-mir-7398ychrX: 57318976-57319034 [+]
mdo-mir-7398ichrX: 57321995-57322057 [+]
mdo-mir-7399chrX: 57326899-57326956 [+]
Database links

Mature sequence mdo-miR-7399-5p

Accession MIMAT0028940
Sequence

1 - 

cacauacauauauagacgugua

 - 22

Get sequence
Deep sequencing8 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7399-3p

Accession MIMAT0028941
Sequence

37 - 

uacgcauguauauguaugcaug

 - 58

Get sequence
Deep sequencing33 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).