Stem-loop sequence mdo-mir-1540b

AccessionMI0024041 (change log)
DescriptionMonodelphis domestica miR-1540b stem-loop
Gene family MIPF0001772; mir-1540
Stem-loop
   --             a    c   gg   u 
5'   gauuccauggagc uaug ucu  cuc c
     ||||||||||||| |||| |||  |||  
3'   cuaagguaucucg guac agg  ggg u
   ca             c    -   ua   g 
Get sequence
Deep sequencing
11682 reads, 160 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 580149267-580149325 [+]
sense
antisense
ENSMODT00000040832 ; mdo-mir-1540a-201; exon 1
Clustered miRNAs
< 10kb from mdo-mir-1540b
mdo-mir-1540achr1: 580149257-580149333 [-]
mdo-mir-1540bchr1: 580149267-580149325 [+]
Database links

Mature sequence mdo-miR-1540b-5p

Accession MIMAT0028938
Sequence

1 - 

gauuccauggagcauaugcucu

 - 22

Get sequence
Deep sequencing265 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-1540b-3p

Accession MIMAT0028939
Sequence

39 - 

acaugcgcucuauggaaucac

 - 59

Get sequence
Deep sequencing11415 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).