Stem-loop sequence mdo-mir-7398i

AccessionMI0024040 (change log)
DescriptionMonodelphis domestica miR-7398i stem-loop
Gene family MIPF0001643; mir-7398
Stem-loop
   --    u    -    gu    g    ---g  ca 
5'   ugug agag ggga  gagg uacu    ug  c
     |||| |||| ||||  |||| ||||    ||   
3'   acac ucuc uccu  uucc augg    ac  u
   ug    -    a    --    a    acua  ua 
Get sequence
Deep sequencing
547 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 57321995-57322057 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7398i
mdo-mir-7398tchrX: 57314588-57314647 [+]
mdo-mir-7398xchrX: 57315816-57315875 [+]
mdo-mir-7398ychrX: 57318976-57319034 [+]
mdo-mir-7398ichrX: 57321995-57322057 [+]
mdo-mir-7399chrX: 57326899-57326956 [+]
Database links

Mature sequence mdo-miR-7398i-5p

Accession MIMAT0028936
Sequence

1 - 

uguguagaggggagugaggguacu

 - 24

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7398i-3p

Accession MIMAT0028937
Sequence

42 - 

uaaccuuuccuacucucacagu

 - 63

Get sequence
Deep sequencing541 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).