Stem-loop sequence mdo-mir-7398t

AccessionMI0024039 (change log)
DescriptionMonodelphis domestica miR-7398t stem-loop
Gene family MIPF0001643; mir-7398
Stem-loop
   --a   u        c    a    g   uc 
5'    gug agaggugg uaag ugcu uga  u
      ||| |||||||| |||| |||| |||   
3'    cac ucuccacc auuu augg acu  g
   uaa   -        u    a    -   cu 
Get sequence
Deep sequencing
88 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 57314588-57314647 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7398t
mdo-mir-7398jchrX: 57306266-57306324 [+]
mdo-mir-7398gchrX: 57307981-57308039 [+]
mdo-mir-7398hchrX: 57311982-57312040 [+]
mdo-mir-7398tchrX: 57314588-57314647 [+]
mdo-mir-7398xchrX: 57315816-57315875 [+]
mdo-mir-7398ychrX: 57318976-57319034 [+]
mdo-mir-7398ichrX: 57321995-57322057 [+]
Database links

Mature sequence mdo-miR-7398t-5p

Accession MIMAT0028934
Sequence

1 - 

aguguagagguggcuaagaugc

 - 22

Get sequence
Deep sequencing53 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7398t-3p

Accession MIMAT0028935
Sequence

40 - 

aauuuauccaccucucacaau

 - 60

Get sequence
Deep sequencing35 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).