Stem-loop sequence mdo-mir-7398h

AccessionMI0024038 (change log)
DescriptionMonodelphis domestica miR-7398h stem-loop
Gene family MIPF0001643; mir-7398
Stem-loop
   ug       ag   u      -   gugc 
5'   ugugaaa  ggg gagggu acu    a
     |||||||  ||| |||||| |||    c
3'   acacuuu  ucc cuccca ugg    u
   ug       cu   -      a   guua 
Get sequence
Deep sequencing
64 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 57311982-57312040 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7398h
mdo-mir-7398jchrX: 57306266-57306324 [+]
mdo-mir-7398gchrX: 57307981-57308039 [+]
mdo-mir-7398hchrX: 57311982-57312040 [+]
mdo-mir-7398tchrX: 57314588-57314647 [+]
mdo-mir-7398xchrX: 57315816-57315875 [+]
mdo-mir-7398ychrX: 57318976-57319034 [+]
Database links

Mature sequence mdo-miR-7398h-5p

Accession MIMAT0028932
Sequence

1 - 

ugugugaaaaggggugaggguacu

 - 24

Get sequence
Deep sequencing7 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7398h-3p

Accession MIMAT0028933
Sequence

38 - 

uaacccucccuucuuucacagu

 - 59

Get sequence
Deep sequencing57 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).