Stem-loop sequence mdo-mir-7398g

AccessionMI0024037 (change log)
DescriptionMonodelphis domestica miR-7398g stem-loop
Stem-loop
   --  u        u     a      guac 
5'   ag guagaggg gguga gaugcu    c
     || |||||||| ||||| ||||||    c
3'   uc cgucucuu ccacu cuauga    c
   ug  -        c     -      acuc 
Get sequence
Deep sequencing
40 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 57307981-57308039 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7398g
mdo-mir-7398schrX: 57298336-57298390 [+]
mdo-mir-7398uchrX: 57301459-57301516 [+]
mdo-mir-7398jchrX: 57306266-57306324 [+]
mdo-mir-7398gchrX: 57307981-57308039 [+]
mdo-mir-7398hchrX: 57311982-57312040 [+]
mdo-mir-7398tchrX: 57314588-57314647 [+]
mdo-mir-7398xchrX: 57315816-57315875 [+]
Database links

Mature sequence mdo-miR-7398g-5p

Accession MIMAT0028930
Sequence

1 - 

aguguagaggguggugaagaugcu

 - 24

Get sequence
Deep sequencing19 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7398g-3p

Accession MIMAT0028931
Sequence

38 - 

uaucucacccuucucugccugu

 - 59

Get sequence
Deep sequencing21 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).