Stem-loop sequence mdo-mir-7398j

AccessionMI0024036 (change log)
DescriptionMonodelphis domestica miR-7398j stem-loop
Gene family MIPF0001643; mir-7398
Stem-loop
   --    u    gg   u    g    a  ca 
5'   ugug agag  gag gagg uacc cg  c
     |||| ||||  ||| |||| |||| ||   
3'   acac ucuc  cuu uucc augg gc  u
   ug    -    au   -    a    -  ua 
Get sequence
Deep sequencing
533 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 57306266-57306324 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7398j
mdo-mir-7398pchrX: 57296466-57296526 [+]
mdo-mir-7398qchrX: 57297040-57297098 [+]
mdo-mir-7398dchrX: 57297721-57297779 [+]
mdo-mir-7398schrX: 57298336-57298390 [+]
mdo-mir-7398uchrX: 57301459-57301516 [+]
mdo-mir-7398jchrX: 57306266-57306324 [+]
mdo-mir-7398gchrX: 57307981-57308039 [+]
mdo-mir-7398hchrX: 57311982-57312040 [+]
mdo-mir-7398tchrX: 57314588-57314647 [+]
mdo-mir-7398xchrX: 57315816-57315875 [+]
Database links

Mature sequence mdo-miR-7398j-5p

Accession MIMAT0028928
Sequence

1 - 

uguguagaggggagugaggguacc

 - 24

Get sequence
Deep sequencing5 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7398j-3p

Accession MIMAT0028929
Sequence

38 - 

uaaccuuuucuacucucacagu

 - 59

Get sequence
Deep sequencing528 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).