Stem-loop sequence mdo-mir-7398s

AccessionMI0024034 (change log)
DescriptionMonodelphis domestica miR-7398s stem-loop
Gene family MIPF0001643; mir-7398
Stem-loop
   u  -      u       aug   uuc 
5'  gu agagaa ggugagu   cug   u
    || |||||| |||||||   |||    
3'  ca ucucuu ccacuua   gac   c
   u  c      c       aug   uau 
Get sequence
Deep sequencing
1232 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 57298336-57298390 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7398s
mdo-mir-7398bchrX: 57288723-57288783 [+]
mdo-mir-7398vchrX: 57289402-57289462 [+]
mdo-mir-7398a-2chrX: 57291703-57291761 [+]
mdo-mir-7398a-4chrX: 57292644-57292702 [+]
mdo-mir-7398a-3chrX: 57293442-57293500 [+]
mdo-mir-7398a-5chrX: 57293921-57293979 [+]
mdo-mir-7398wchrX: 57294562-57294624 [+]
mdo-mir-7398pchrX: 57296466-57296526 [+]
mdo-mir-7398qchrX: 57297040-57297098 [+]
mdo-mir-7398dchrX: 57297721-57297779 [+]
mdo-mir-7398schrX: 57298336-57298390 [+]
mdo-mir-7398uchrX: 57301459-57301516 [+]
mdo-mir-7398jchrX: 57306266-57306324 [+]
mdo-mir-7398gchrX: 57307981-57308039 [+]
Database links

Mature sequence mdo-miR-7398s-5p

Accession MIMAT0028924
Sequence

1 - 

uguagagaauggugaguaugcu

 - 22

Get sequence
Deep sequencing1174 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7398s-3p

Accession MIMAT0028925
Sequence

35 - 

guaauucacccuucucucacu

 - 55

Get sequence
Deep sequencing58 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).