Stem-loop sequence mdo-mir-7398b

AccessionMI0024026 (change log)
DescriptionMonodelphis domestica miR-7398b stem-loop
Gene family MIPF0001643; mir-7398
Stem-loop
   --    u    au       a    guguuu 
5'   ugug agag  gggaaau ugcu      u
     |||| ||||  ||||||| ||||       
3'   acac ucuc  uucuuua augg      c
   ug    -    cg       a    ucuucu 
Get sequence
Deep sequencing
163 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 57288723-57288783 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7398b
mdo-mir-7398fchrX: 57279275-57279333 [+]
mdo-mir-7398a-1chrX: 57282764-57282822 [+]
mdo-mir-7398rchrX: 57283471-57283531 [+]
mdo-mir-7398nchrX: 57284128-57284188 [+]
mdo-mir-7398k-1chrX: 57284809-57284869 [+]
mdo-mir-7398k-2chrX: 57285473-57285533 [+]
mdo-mir-7398ochrX: 57286131-57286191 [+]
mdo-mir-7398lchrX: 57286820-57286880 [+]
mdo-mir-7398mchrX: 57287463-57287521 [+]
mdo-mir-7398cchrX: 57288057-57288117 [+]
mdo-mir-7398bchrX: 57288723-57288783 [+]
mdo-mir-7398vchrX: 57289402-57289462 [+]
mdo-mir-7398a-2chrX: 57291703-57291761 [+]
mdo-mir-7398a-4chrX: 57292644-57292702 [+]
mdo-mir-7398a-3chrX: 57293442-57293500 [+]
mdo-mir-7398a-5chrX: 57293921-57293979 [+]
mdo-mir-7398wchrX: 57294562-57294624 [+]
mdo-mir-7398pchrX: 57296466-57296526 [+]
mdo-mir-7398qchrX: 57297040-57297098 [+]
mdo-mir-7398dchrX: 57297721-57297779 [+]
mdo-mir-7398schrX: 57298336-57298390 [+]
Database links

Mature sequence mdo-miR-7398b-5p

Accession MIMAT0028916
Sequence

1 - 

uguguagagaugggaaauaugcu

 - 23

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7398b-3p

Accession MIMAT0028917
Sequence

40 - 

uaaauuucuugccucucacagu

 - 61

Get sequence
Deep sequencing160 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).