Stem-loop sequence mdo-mir-7398e

AccessionMI0024015 (change log)
DescriptionMonodelphis domestica miR-7398e stem-loop
Gene family MIPF0001643; mir-7398
Stem-loop
   --    u         u   aaug   ugu 
5'   agug agagaaggg gaa    cug   u
     |||| ||||||||| |||    |||    
3'   ucau ucucuuccc cuu    gac   c
   ug    -         u   aaug   ugu 
Get sequence
Deep sequencing
510 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 57276306-57276364 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7398e
mdo-mir-7398echrX: 57276306-57276364 [+]
mdo-mir-7398fchrX: 57279275-57279333 [+]
mdo-mir-7398a-1chrX: 57282764-57282822 [+]
mdo-mir-7398rchrX: 57283471-57283531 [+]
mdo-mir-7398nchrX: 57284128-57284188 [+]
mdo-mir-7398k-1chrX: 57284809-57284869 [+]
mdo-mir-7398k-2chrX: 57285473-57285533 [+]
mdo-mir-7398ochrX: 57286131-57286191 [+]
Database links

Mature sequence mdo-miR-7398e-5p

Accession MIMAT0028896
Sequence

1 - 

aguguagagaagggugaaaaugc

 - 23

Get sequence
Deep sequencing9 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7398e-3p

Accession MIMAT0028897
Sequence

38 - 

uaauucucccuucucuuacugu

 - 59

Get sequence
Deep sequencing501 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).