Stem-loop sequence mdo-mir-7394b

AccessionMI0024014 (change log)
DescriptionMonodelphis domestica miR-7394b stem-loop
Stem-loop
   --         c c       u  cug 
5'   acauguaug c agguuac ug   c
     ||||||||| | ||||||| ||    
3'   uguacauac g uccagug ac   u
   cu         c u       u  auc 
Get sequence
Deep sequencing
426 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 47675602-47675655 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7394b
mdo-mir-7394cchrX: 47667188-47667240 [+]
mdo-mir-7396chrX: 47667356-47667411 [+]
mdo-mir-7397chrX: 47672118-47672173 [+]
mdo-mir-7394bchrX: 47675602-47675655 [+]
Database links

Mature sequence mdo-miR-7394b-5p

Accession MIMAT0028894
Sequence

1 - 

acauguaugcccagguuacuug

 - 22

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7394b-3p

Accession MIMAT0028895
Sequence

33 - 

ugugaccuugccauacauguuc

 - 54

Get sequence
Deep sequencing422 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).