Stem-loop sequence mdo-mir-7397

AccessionMI0024013 (change log)
DescriptionMonodelphis domestica miR-7397 stem-loop
Stem-loop
   --       uu     a  g  --a   g 
5'   aaucugu  gucuu gu ac   ugu c
     |||||||  ||||| || ||   |||  
3'   uuagaca  cagaa ca ug   aua a
   cc       cc     c  g  gaa   a 
Get sequence
Deep sequencing
140 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 47672118-47672173 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7397
mdo-mir-7394cchrX: 47667188-47667240 [+]
mdo-mir-7396chrX: 47667356-47667411 [+]
mdo-mir-7397chrX: 47672118-47672173 [+]
mdo-mir-7394bchrX: 47675602-47675655 [+]
Database links

Mature sequence mdo-miR-7397-5p

Accession MIMAT0028892
Sequence

1 - 

aaucuguuugucuuagugaca

 - 21

Get sequence
Deep sequencing32 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7397-3p

Accession MIMAT0028893
Sequence

36 - 

ugaccaagacccacagauucc

 - 56

Get sequence
Deep sequencing108 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).