Stem-loop sequence mdo-mir-7396

AccessionMI0024012 (change log)
DescriptionMonodelphis domestica miR-7396 stem-loop
Stem-loop
   --u            u       uguca 
5'    aucuguauaucu gguuaug     u
      |||||||||||| |||||||      
3'    uggacauguaga ccagugc     c
   ccu            u       uaauc 
Get sequence
Deep sequencing
683 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 47667356-47667411 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7396
mdo-mir-7394achrX: 47660934-47660987 [+]
mdo-mir-7395chrX: 47661482-47661537 [+]
mdo-mir-7394cchrX: 47667188-47667240 [+]
mdo-mir-7396chrX: 47667356-47667411 [+]
mdo-mir-7397chrX: 47672118-47672173 [+]
mdo-mir-7394bchrX: 47675602-47675655 [+]
Database links

Mature sequence mdo-miR-7396-5p

Accession MIMAT0028890
Sequence

1 - 

uaucuguauaucuugguuaug

 - 21

Get sequence
Deep sequencing682 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7396-3p

Accession MIMAT0028891
Sequence

36 - 

ugaccuagauguacagguucc

 - 56

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).