Stem-loop sequence mdo-mir-7395

AccessionMI0024011 (change log)
DescriptionMonodelphis domestica miR-7395 stem-loop
Stem-loop
   --u    c       c   aa     ucc 
5'    acac uauacuc ggu  cauau   u
      |||| ||||||| |||  |||||    
3'    ugug auauggg cca  guaua   c
   ccu    u       a   --     cac 
Get sequence
Deep sequencing
72 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 47661482-47661537 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7395
mdo-mir-7393chrX: 47653726-47653777 [+]
mdo-mir-7392-2chrX: 47656551-47656607 [+]
mdo-mir-7394achrX: 47660934-47660987 [+]
mdo-mir-7395chrX: 47661482-47661537 [+]
mdo-mir-7394cchrX: 47667188-47667240 [+]
mdo-mir-7396chrX: 47667356-47667411 [+]
Database links

Mature sequence mdo-miR-7395-5p

Accession MIMAT0028888
Sequence

1 - 

uacaccuauacuccgguaacauau

 - 24

Get sequence
Deep sequencing19 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7395-3p

Accession MIMAT0028889
Sequence

35 - 

augaccaggguauauguguucc

 - 56

Get sequence
Deep sequencing53 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).