Stem-loop sequence mdo-mir-7393

AccessionMI0024009 (change log)
DescriptionMonodelphis domestica miR-7393 stem-loop
Stem-loop
   --  a      uuu         guu 
5'   cg guauau   ggucacaug   a
     || ||||||   |||||||||    
3'   gc cauaug   ccaguguac   c
   cu  c      uuu         auc 
Get sequence
Deep sequencing
1068 reads, 50 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 47653726-47653777 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7393
mdo-mir-7392-1chrX: 47647594-47647650 [+]
mdo-mir-7393chrX: 47653726-47653777 [+]
mdo-mir-7392-2chrX: 47656551-47656607 [+]
mdo-mir-7394achrX: 47660934-47660987 [+]
mdo-mir-7395chrX: 47661482-47661537 [+]
Database links

Mature sequence mdo-miR-7393-5p

Accession MIMAT0028884
Sequence

1 - 

cgaguauauuuuggucacaug

 - 21

Get sequence
Deep sequencing10 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7393-3p

Accession MIMAT0028885
Sequence

32 - 

ugugaccuuuguauacccguc

 - 52

Get sequence
Deep sequencing1058 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).