Stem-loop sequence mdo-mir-7392-2

AccessionMI0024008 (change log)
DescriptionMonodelphis domestica miR-7392-2 stem-loop
Gene family MIPF0001725; mir-7392
Stem-loop
   --u        ac u       g    ag 
5'    acgaguau  c ugguuac uguu  u
      ||||||||  | ||||||| ||||   
3'    ugcucaua  g accaaug auaa  a
   ccu        ca u       -    aa 
Get sequence
Deep sequencing
2215 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 47656551-47656607 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7392-2
mdo-mir-7392-1chrX: 47647594-47647650 [+]
mdo-mir-7393chrX: 47653726-47653777 [+]
mdo-mir-7392-2chrX: 47656551-47656607 [+]
mdo-mir-7394achrX: 47660934-47660987 [+]
mdo-mir-7395chrX: 47661482-47661537 [+]
Database links

Mature sequence mdo-miR-7392-5p

Accession MIMAT0028882
Sequence

1 - 

uacgaguauaccuugguuacgu

 - 22

Get sequence
Deep sequencing4232 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7392-3p

Accession MIMAT0028883
Sequence

36 - 

guaaccaugacauacucguucc

 - 57

Get sequence
Deep sequencing198 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).