Stem-loop sequence mdo-mir-1-2

AccessionMI0024006 (change log)
DescriptionMonodelphis domestica miR-1-2 stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
   --       a        gc     ugaacg 
5'   acauacu cuuuauau  ccaua      u
     ||||||| ||||||||  |||||       
3'   uguauga gaaaugua  gguau      g
   ua       a        -a     cgaauc 
Get sequence
Deep sequencing
8143936 reads, 1.09e+05 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 476676455-476676515 [-]
sense
ENSMODT00000040376 ; mdo-mir-1-2-201; exon 1
Database links

Mature sequence mdo-miR-1-2-5p

Accession MIMAT0031035
Sequence

1 - 

acauacuacuuuauaugcccaua

 - 23

Get sequence
Deep sequencing19 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-1-3p

Accession MIMAT0004085
Sequence

40 - 

uggaauguaaagaaguauguau

 - 61

Get sequence
Deep sequencing16574010 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).