Stem-loop sequence mdo-mir-7391

AccessionMI0024005 (change log)
DescriptionMonodelphis domestica miR-7391 stem-loop
Stem-loop
   --c     u     u  a        uuga 
5'    cgugg auggu ag aagcugcc    u
      ||||| ||||| || ||||||||    c
3'    guacc uaccg uc uucgacgg    a
   uau     -     -  g        uaau 
Get sequence
Deep sequencing
8298 reads, 125 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 41863234-41863292 [+]
sense
Database links

Mature sequence mdo-miR-7391-5p

Accession MIMAT0028880
Sequence

1 - 

ccgugguaugguuagaaagcugc

 - 23

Get sequence
Deep sequencing8164 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7391-3p

Accession MIMAT0028881
Sequence

39 - 

agcuugcugccauccauguau

 - 59

Get sequence
Deep sequencing134 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).