Stem-loop sequence mdo-mir-7390

AccessionMI0024003 (change log)
DescriptionMonodelphis domestica miR-7390 stem-loop
Stem-loop
   --auu     c         a    uaua 
5'      uguac uaauacaac uuug    a
        ||||| ||||||||| ||||     
3'      acaug auuauguug aagc    c
   ugagu     u         a    ugua 
Get sequence
Deep sequencing
58 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 40522765-40522822 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7390
mdo-mir-7389chrX: 40514663-40514725 [+]
mdo-mir-7388bchrX: 40516163-40516222 [+]
mdo-mir-7388cchrX: 40516906-40516960 [+]
mdo-mir-7390chrX: 40522765-40522822 [+]
Database links

Mature sequence mdo-miR-7390-5p

Accession MIMAT0028876
Sequence

1 - 

auuuguaccuaauacaacauuu

 - 22

Get sequence
Deep sequencing19 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7390-3p

Accession MIMAT0028877
Sequence

37 - 

aaguuguauuauguacaugagu

 - 58

Get sequence
Deep sequencing39 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).