Stem-loop sequence mdo-mir-7388c

AccessionMI0024002 (change log)
DescriptionMonodelphis domestica miR-7388c stem-loop
Stem-loop
   --        -c     -      u   u 
5'   ugcacaga  gugac auuuua guc u
     ||||||||  ||||| |||||| |||  
3'   auguguuu  cacug uaaaau uag a
   ca        uc     a      -   u 
Get sequence
Deep sequencing
39 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 40516906-40516960 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7388c
mdo-mir-7389chrX: 40514663-40514725 [+]
mdo-mir-7388bchrX: 40516163-40516222 [+]
mdo-mir-7388cchrX: 40516906-40516960 [+]
mdo-mir-7390chrX: 40522765-40522822 [+]
Database links

Mature sequence mdo-miR-7388c-5p

Accession MIMAT0028874
Sequence

1 - 

ugcacagacgugacauuuua

 - 20

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7388c-3p

Accession MIMAT0028875
Sequence

34 - 

aaauagucaccuuuuguguaac

 - 55

Get sequence
Deep sequencing36 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).