Stem-loop sequence mdo-mir-7388b

AccessionMI0024001 (change log)
DescriptionMonodelphis domestica miR-7388b stem-loop
Stem-loop
   --         -    uu  -       gua 
5'   uguugcaca gaug  ac auuuuau   u
     ||||||||| ||||  || |||||||    
3'   acaacgugu cuac  ug uaaaaua   g
   ug         a    cc  a       guc 
Get sequence
Deep sequencing
1731 reads, 60 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 40516163-40516222 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7388b
mdo-mir-7388achrX: 40506274-40506332 [+]
mdo-mir-7389chrX: 40514663-40514725 [+]
mdo-mir-7388bchrX: 40516163-40516222 [+]
mdo-mir-7388cchrX: 40516906-40516960 [+]
mdo-mir-7390chrX: 40522765-40522822 [+]
Database links

Mature sequence mdo-miR-7388b-5p

Accession MIMAT0028872
Sequence

1 - 

uguugcacagauguuacauuu

 - 21

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7388b-3p

Accession MIMAT0028873
Sequence

38 - 

auagucccaucaugugcaacagu

 - 60

Get sequence
Deep sequencing1728 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).