Stem-loop sequence mdo-mir-7389

AccessionMI0024000 (change log)
DescriptionMonodelphis domestica miR-7389 stem-loop
Stem-loop
   --     a uu  a            a   c 
5'   gcugu c  ga gcaauuuuuuuu uau u
     ||||| |  || |||||||||||| ||| a
3'   cgaca g  cu cguugaaaaaaa aug u
   ga     a uu  a            a   u 
Get sequence
Deep sequencing
8121 reads, 375 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 40514663-40514725 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7389
mdo-mir-7386ochrX: 40504972-40505028 [+]
mdo-mir-7388achrX: 40506274-40506332 [+]
mdo-mir-7389chrX: 40514663-40514725 [+]
mdo-mir-7388bchrX: 40516163-40516222 [+]
mdo-mir-7388cchrX: 40516906-40516960 [+]
mdo-mir-7390chrX: 40522765-40522822 [+]
Database links

Mature sequence mdo-miR-7389-5p

Accession MIMAT0028870
Sequence

1 - 

gcuguacuugaagcaauuuuuu

 - 22

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7389-3p

Accession MIMAT0028871
Sequence

42 - 

aaaguugcaucuugaacagcag

 - 63

Get sequence
Deep sequencing8116 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).