Stem-loop sequence mdo-mir-133a-2

AccessionMI0023999 (change log)
DescriptionMonodelphis domestica miR-133a-2 stem-loop
Gene family MIPF0000029; mir-133
Stem-loop
   --       aaa    -a        accug 
5'   agcuggu   aagg  accaaauc     u
     |||||||   ||||  ||||||||      
3'   ucgacca   uucc  ugguuuag     g
   ug       -ac    cc        guagc 
Get sequence
Deep sequencing
17542 reads, 120 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 476650621-476650680 [-]
sense
ENSMODT00000028270 ; mdo-mir-133a-2-201; exon 1
Database links

Mature sequence mdo-miR-133a-2-5p

Accession MIMAT0031113
Sequence

1 - 

agcugguaaaaaggaaccaaau

 - 22

Get sequence
Deep sequencing2281 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-133a-3p

Accession MIMAT0004107
Sequence

39 - 

uugguccccuucaaccagcugu

 - 60

Get sequence
Deep sequencing34219 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).